CMV_Mex3a_mutRING_t2a_mCherry
(Plasmid
#223245)
-
PurposeExpression of mutant RING Mex3a in mammalian cells with t2a cleaved mCherry
-
Depositing Lab
-
Depositing OrganizationColumbia University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 223245-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 223245-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTRE2
- Total vector size (bp) 5777
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMex3a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1560
-
Mutation4 point mutations in RING Domain: Cys 484 Ala; His 486 Ala; Cys 490 Ala; Cys 493 Ala
-
Entrez GeneMex3a (a.k.a. 2700083E18Rik, Gm411, Rkhd4)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer TGGAGACGCCATCCACGCTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note, this mutantRING version of Mex3a preserves mus musculus amino acids for Mex3a (except the four amino acids of RING domain's cross brace structure), but changes the underlying DNA sequence to reduce CG content.
DNA (Catalog # 223245-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 223245-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV_Mex3a_mutRING_t2a_mCherry was a gift from Stavros Lomvardas (Addgene plasmid # 223245 ; http://n2t.net/addgene:223245 ; RRID:Addgene_223245)