pTrc-clbS
(Plasmid
#223350)
-
PurposeEncoding wild type ClbS from E. coli CFT073
-
Depositing Lab
-
Depositing OrganizationHarvard University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223350 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTrcHis 2A
-
Backbone manufacturerThermofisher scientific
- Backbone size w/o insert (bp) 4257
- Total vector size (bp) 4770
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameClbS from CFT073 (Codon optimized for E coli)
-
SpeciesE. coli
-
Insert Size (bp)513
- Promoter pTrc
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGAAAAAGCGAAGCGGCACTGCT
- 3′ sequencing primer GCATGGGGTCAGGTGGGACC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTrc-clbS was a gift from Emily Balskus (Addgene plasmid # 223350 ; http://n2t.net/addgene:223350 ; RRID:Addgene_223350) -
For your References section:
The bacterial toxin colibactin triggers prophage induction. Silpe JE, Wong JWH, Owen SV, Baym M, Balskus EP. Nature. 2022 Mar;603(7900):315-320. doi: 10.1038/s41586-022-04444-3. Epub 2022 Feb 23. 10.1038/s41586-022-04444-3 PubMed 35197633