pHR-SNAP-CD86iso2
(Plasmid
#223574)
-
PurposeLentiviral expression of human CD86 isoform 2 with SNAP tag in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223574 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHR
-
Vector typeLentiviral ; Mammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD86
-
SpeciesH. sapiens (human)
-
Entrez GeneCD86 (a.k.a. B7-2, B7.2, B70, CD28LG2, LAB72)
-
Tag
/ Fusion Protein
- SNAP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccaatcagcctgcttctcgcttc
- 3′ sequencing primer ccagaggttgattatcgataagc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid lab code: L607
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-SNAP-CD86iso2 was a gift from Enfu Hui (Addgene plasmid # 223574 ; http://n2t.net/addgene:223574 ; RRID:Addgene_223574) -
For your References section:
Antigen-Presenting Cell-Intrinsic PD-1 Neutralizes PD-L1 in cis to Attenuate PD-1 Signaling in T Cells. Zhao Y, Harrison DL, Song Y, Ji J, Huang J, Hui E. Cell Rep. 2018 Jul 10;24(2):379-390.e6. doi: 10.1016/j.celrep.2018.06.054. 10.1016/j.celrep.2018.06.054 PubMed 29996099