pcDNA-mGFP-Eps15DN
(Plasmid
#223621)
-
PurposeTransient expression of human Eps15 with mEGFP tag in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223621 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 223621-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 223621-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEps15
-
SpeciesH. sapiens (human)
-
MutationEps15 _ 95-295aa
-
Entrez GeneEPS15 (a.k.a. AF-1P, AF1P, MLLT5)
-
Tag
/ Fusion Protein
- mEGFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer gaaatttgtgatgctattgc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid lab code: L1977
DNA (Catalog # 223621-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 223621-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA-mGFP-Eps15DN was a gift from Enfu Hui (Addgene plasmid # 223621 ; http://n2t.net/addgene:223621 ; RRID:Addgene_223621) -
For your References section:
cis-B7:CD28 interactions at invaginated synaptic membranes provide CD28 co-stimulation and promote CD8(+) T cell function and anti-tumor immunity. Zhao Y, Caron C, Chan YY, Lee CK, Xu X, Zhang J, Masubuchi T, Wu C, Bui JD, Hui E. Immunity. 2023 Jun 13;56(6):1187-1203.e12. doi: 10.1016/j.immuni.2023.04.005. Epub 2023 May 8. 10.1016/j.immuni.2023.04.005 PubMed 37160118