PB-GFP11x7-HygR
(Plasmid
#223676)
-
PurposeTo check the split GFP signals in mitochondria (2)
-
Depositing Lab
-
Depositing OrganizationBoston Children's Hospital
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 223676 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 223676-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 223676-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePiggyBac
- Total vector size (bp) 8292
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP11x7
-
Alt nameGFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)887
-
GenBank ID
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP11 (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gacattgattattgactagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 223676-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 223676-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-GFP11x7-HygR was a gift from Juan Melero-Martin (Addgene plasmid # 223676 ; http://n2t.net/addgene:223676 ; RRID:Addgene_223676) -
For your References section:
Mitochondrial transfer mediates endothelial cell engraftment through mitophagy. Lin RZ, Im GB, Luo AC, Zhu Y, Hong X, Neumeyer J, Tang HW, Perrimon N, Melero-Martin JM. Nature. 2024 May;629(8012):660-668. doi: 10.1038/s41586-024-07340-0. Epub 2024 May 1. 10.1038/s41586-024-07340-0 PubMed 38693258
Map uploaded by the depositor.
