Skip to main content
Addgene
Open Menu

pLV-H2B-iRFP670-p2a-YFP-Rb-IRES-blasticidin
(Plasmid #223962)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 223962 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 223962-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 223962-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pLV-EF1a-IRES-blasticidin
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    H2B-iRFP670-p2a-YFP-Rb
  • Alt name
    H2B
  • Alt name
    Rb
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4890
  • Entrez Gene
    RB1 (a.k.a. OSRC, PPP1R130, RB, p105-Rb, p110-RB1, pRb, pp110)
  • Entrez Gene
    H2B
  • Promoter EF-1a
  • Tags / Fusion Proteins
    • iRFP670
    • YFP

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer For H2B-iRFP670: catttcaggtgtcgtgagggatccgccacc; For YFP-Rb: CCGGTCCTTCTAAAGGTGAAGAATTATTCACTGGTGTTGT
  • 3′ sequencing primer For H2B-iRFP670: acctttagaaggaccgggattttcttccac; For YFP-Rb: cggccgccctcgaggaattcTTATTTCTCTTCCTTGTTTGAGGTATCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-H2B-iRFP670-p2a-YFP-Rb-IRES-blasticidin was a gift from Hee Won Yang (Addgene plasmid # 223962 ; http://n2t.net/addgene:223962 ; RRID:Addgene_223962)

  • For your References section:

    Sequential activation of E2F via Rb degradation and c-Myc drives resistance to CDK4/6 inhibitors in breast cancer. Kim S, Armand J, Safonov A, Zhang M, Soni RK, Schwartz G, McGuinness JE, Hibshoosh H, Razavi P, Kim M, Chandarlapaty S, Yang HW. Cell Rep. 2023 Nov 28;42(11):113198. doi: 10.1016/j.celrep.2023.113198. Epub 2023 Oct 21. 10.1016/j.celrep.2023.113198 PubMed 37865915
Related items: