pubc-FRB-SMG7C-IRES-FKBP-HaloTag_tdMCP-NLS-HA (RIDR)
(Plasmid
#224132)
-
PurposeRIDR serves as a tool for exploring the spatiotemporal RNA metabolism in cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224132 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonephage ubc
- Backbone size w/o insert (bp) 6250
- Total vector size (bp) 10047
-
Vector typeMammalian Expression
-
Selectable markersHaloTag
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepubc-FRB-SMG7C-IRES-FKBP-HaloTag_tdMCP-NLS-HA
-
Alt nameRIDR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3797
- Promoter ubc
-
Tags
/ Fusion Proteins
- FRB-SMG7C (N terminal on insert)
- FKBP-HaloTag-tdMCP-NLS-HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCCGATGATTATATAAGGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pubc-FRB-SMG7C-IRES-FKBP-HaloTag_tdMCP-NLS-HA (RIDR) was a gift from Bin Wu (Addgene plasmid # 224132 ; http://n2t.net/addgene:224132 ; RRID:Addgene_224132) -
For your References section:
A rapid inducible RNA decay system reveals fast mRNA decay in P-bodies. Blake LA, Watkins L, Liu Y, Inoue T, Wu B. Nat Commun. 2024 Mar 28;15(1):2720. doi: 10.1038/s41467-024-46943-z. 10.1038/s41467-024-46943-z PubMed 38548718