pJExpress401-KDAC4 CD H976Y
(Plasmid
#224250)
-
PurposeExpresses human KDAC4 (HDAC4) catalytic domain H976Y in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224250 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepJExpress401
-
Backbone manufacturerDNA 2.0
- Backbone size w/o insert (bp) 3936
- Total vector size (bp) 5292
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKDAC4
-
Alt nameHDAC4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1356
-
MutationOnly includes residues 648-1083 (catalytic domain). Histidine 976 mutated to tyrosine.
-
Entrez GeneHDAC4 (a.k.a. AHO3, BDMR, HA6116, HD4, HDAC-4, HDAC-A, HDACA, NEDCHF, NEDCHID)
- Promoter T5
-
Tag
/ Fusion Protein
- TEV-cleavable His6 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTCGAAAATAATAAAGGGAAAATCAG
- 3′ sequencing primer TGGTAGTGTGGGGACTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Codon optimized for bacterial expression. Catalytic domain only. Has enhanced activity with acetylated peptides compared to wild-type.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJExpress401-KDAC4 CD H976Y was a gift from Terry Watt (Addgene plasmid # 224250 ; http://n2t.net/addgene:224250 ; RRID:Addgene_224250) -
For your References section:
Lysine Deacetylases Exhibit Distinct Changes in Activity Profiles Due to Fluorophore Conjugation of Substrates. Toro TB, Bryant JR, Watt TJ. Biochemistry. 2017 Aug 29;56(34):4549-4558. doi: 10.1021/acs.biochem.7b00270. Epub 2017 Aug 16. 10.1021/acs.biochem.7b00270 PubMed 28749131