pFastBacI-KDAC6 H216A
(Plasmid
#224351)
-
PurposeExpresses human KDAC6 (HDAC6) H216A in insect cells
-
Depositing Lab
-
Depositing OrganizationXavier University of Louisiana
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224351 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepFastBacI
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 4682
- Total vector size (bp) 8369
-
Modifications to backboneRemoval of one NheI site
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKDAC6
-
Alt nameHDAC6
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3687
-
MutationHistidine 216 mutated to alanine
-
Entrez GeneHDAC6 (a.k.a. CPBHM, HD6, JM21, KDAC6, PPP1R90)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- TEV-cleavable His6 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CTAGTGGTTGGCTACGTATACTC
- 3′ sequencing primer CCTCTACAAATGTGGTATGGCTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEric Verdin: Addgene 13823 (pcDNA3.1+ HDAC6 Flag).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBacI-KDAC6 H216A was a gift from Terry Watt (Addgene plasmid # 224351 ; http://n2t.net/addgene:224351 ; RRID:Addgene_224351) -
For your References section:
Lysine Deacetylase Substrate Selectivity: Distinct Interaction Surfaces Drive Positive and Negative Selection for Residues Following Acetyllysine. Toro TB, Bornes KE, Watt TJ. Biochemistry. 2023 May 2;62(9):1464-1483. doi: 10.1021/acs.biochem.3c00001. Epub 2023 Apr 12. 10.1021/acs.biochem.3c00001 PubMed 37043688