Skip to main content

pFastBacI-KDAC6 H611A
(Plasmid #224352)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 224352 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pFastBacI
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 4682
  • Total vector size (bp) 8369
  • Modifications to backbone
    Removal of one NheI site
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KDAC6
  • Alt name
    HDAC6
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3687
  • Mutation
    Histidine 611 mutated to alanine
  • Entrez Gene
    HDAC6 (a.k.a. CPBHM, HD6, JM21, KDAC6, PPP1R90)
  • Promoter Polyhedrin
  • Tag / Fusion Protein
    • TEV-cleavable His6 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CTAGTGGTTGGCTACGTATACTC
  • 3′ sequencing primer CCTCTACAAATGTGGTATGGCTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Eric Verdin: Addgene 13823 (pcDNA3.1+ HDAC6 Flag).

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBacI-KDAC6 H611A was a gift from Terry Watt (Addgene plasmid # 224352 ; http://n2t.net/addgene:224352 ; RRID:Addgene_224352)
  • For your References section:

    Lysine Deacetylase Substrate Selectivity: Distinct Interaction Surfaces Drive Positive and Negative Selection for Residues Following Acetyllysine. Toro TB, Bornes KE, Watt TJ. Biochemistry. 2023 May 2;62(9):1464-1483. doi: 10.1021/acs.biochem.3c00001. Epub 2023 Apr 12. 10.1021/acs.biochem.3c00001 PubMed 37043688