pCAG-Cas13d-T2A-GFP(1-10)
(Plasmid
#224566)
-
PurposeUbiquitous expression plasmid, contains CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), Cas13d, and split GFP(1-10) reporter.
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 224566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 224566-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 224566-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAG-memRFP
-
Modifications to backboneExcised memRFP
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCas13d-T2A-GFP(1-10)
-
SpeciesRuminococcus flavefaciens
-
Tag
/ Fusion Protein
- T2A-split GFP(1-10) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer tacagctcctgggcaacgtg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 224566-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 224566-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-Cas13d-T2A-GFP(1-10) was a gift from Erica Hutchins (Addgene plasmid # 224566 ; http://n2t.net/addgene:224566 ; RRID:Addgene_224566) -
For your References section:
CRISPR-Cas13d as a molecular tool to achieve targeted gene expression knockdown in chick embryos. Kim M, Hutchins EJ. Dev Biol. 2024 Nov 30:S0012-1606(24)00265-3. doi: 10.1016/j.ydbio.2024.11.013. 10.1016/j.ydbio.2024.11.013 PubMed 39622311
Map uploaded by the depositor.
