Skip to main content

pPICZ:K2P2.1(mTREK-1)Cryst S112C
(Plasmid #224780)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 224780 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pPICZ
  • Vector type
    Yeast Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Potassium channel subfamily K member 2
  • Alt name
    Kcnk2
  • Alt name
    TREK-1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1713
  • Mutation
    K84R / Q85E / T86K / I88L / A89R / Q90A / A92P / N95S / S96D / T97Q / N119A / S300A / E306A
  • Entrez Gene
    Kcnk2 (a.k.a. A430027H14Rik, TREK-1)
  • Promoter AOX1 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XhaI (not destroyed)
  • 5′ sequencing primer GACTGGTTCCAATTGACAAGC
  • 3′ sequencing primer gttggtgatcagctaggaac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPICZ:K2P2.1(mTREK-1)Cryst S112C was a gift from Dan Minor (Addgene plasmid # 224780 ; http://n2t.net/addgene:224780 ; RRID:Addgene_224780)
  • For your References section:

    Development of covalent chemogenetic K(2P) channel activators. Deal PE, Lee H, Mondal A, Lolicato M, Mendonca PRF, Black H, Jang S, El-Hilali X, Bryant C, Isacoff EY, Renslo AR, Minor DL Jr. Cell Chem Biol. 2024 Jul 18;31(7):1305-1323.e9. doi: 10.1016/j.chembiol.2024.06.006. 10.1016/j.chembiol.2024.06.006 PubMed 39029456