pGP-Tn7-Pcym
(Plasmid
#225280)
-
Purpose(Empty Backbone) Mini-Tn7 pGP-Tn7-Cm vector with inducible Pcym cumate promoter for the inducible/controlled expression of target genes inserted into the attTn7 chromosomal site.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225280 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGP-Tn7-Cm
- Backbone size (bp) 6943
-
Vector typeBacterial Expression
- Promoter Pcym cumate (p-isopropylbenzoate)-inducible promoter
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberUnknown
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTGACATAAGCCTGTTCGG
- 3′ sequencing primer AAATAGATGGGAACTGGGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGP-Tn7-Pcym was a gift from Mark Schembri (Addgene plasmid # 225280 ; http://n2t.net/addgene:225280 ; RRID:Addgene_225280) -
For your References section:
Modified Tn7 transposon vectors for controlled chromosomal gene expression. Chang C, Phan M-D, Schembri MA. Appl Environ Microbiol. 2024 Oct 23;90(10):e0155624. doi: 10.1128/aem.01556-24. Epub 2024 Sep 18. 10.1128/aem.01556-24 PubMed 39291982