pDGB3_alpha1_35S-eGFP-T35S (GB4279)
(Plasmid
#225434)
-
PurposeTranscriptional unit for constitutive expression of the enhanced GFP.
-
Depositing Lab
-
Depositing OrganizationInstituto de Biologia Molecular y Celular de Plantas
Located in Spain -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225434 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 225434-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 225434-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepDGB3_alpha1
-
Backbone manufacturerself-made
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name35S:eGFP:T35S
-
SpeciesSynthetic
-
Insert Size (bp)1987
-
MutationBsaI and BsmBI sites removed
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer ggtggcaggatatattgtgg
- 3′ sequencing primer cgcccttttaaatatccgatt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Compatible with GoldenBraid; insert can be released with BsmbI.
Please visit https://doi.org/10.1101/2024.04.30.591823 for bioRxiv preprint.
DNA (Catalog # 225434-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 225434-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB3_alpha1_35S-eGFP-T35S (GB4279) was a gift from Diego Orzaez (Addgene plasmid # 225434 ; http://n2t.net/addgene:225434 ; RRID:Addgene_225434) -
For your References section:
CuBe: a geminivirus-based copper-regulated expression system suitable for post-harvest activation. Garcia-Perez E, Vazquez-Vilar M, Lozano-Duran R, Orzaez D. Plant Biotechnol J. 2025 Jan;23(1):141-155. doi: 10.1111/pbi.14485. Epub 2024 Oct 22. 10.1111/pbi.14485 PubMed 39435699