pcDNA3puro-mGFP-FMR1 isoform1-sh1Resistant
(Plasmid
#225462)
-
PurposeExpress mEGFP-fusion protein of FMR1 isoform 1
-
Depositing Lab
-
Depositing OrganizationMemorial Sloan-Kettering Cancer Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 225462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 225462-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 225462-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3-puro
-
Backbone manufacturerMayr Lab
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFMR1 isoform 1
-
SpeciesH. sapiens (human)
-
Entrez GeneFMR1 (a.k.a. FMRP, FRAXA, POF, POF1)
- Promoter CMV
-
Tag
/ Fusion Protein
- mEGFP (N terminal on insert)
Cloning Information
- Cloning method Other
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Resistant to shRNA TRCN0000059759 (target sequence GCGTTTGGAGAGATTACAAAT). Please visit https://doi.org/10.1101/2023.11.05.565677 for bioRxiv preprint.
DNA (Catalog # 225462-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 225462-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3puro-mGFP-FMR1 isoform1-sh1Resistant was a gift from Christine Mayr (Addgene plasmid # 225462 ; http://n2t.net/addgene:225462 ; RRID:Addgene_225462) -
For your References section:
The FXR1 network acts as signaling scaffold for actomyosin remodeling. Chen X, Fansler MM, Janjoš U, Ule J, Mayr C. Cell. 5 August 2024. doi: 10.1016/j.cell.2024.07.015. 10.1016/j.cell.2024.07.015 PubMed 37961296