GCaMP-AMPK-SPARK
(Plasmid
#226257)
-
PurposeDual reporter of Ca2+ levels and AMPK activity
-
Depositing Lab
-
Depositing OrganizationMedical University of Graz
Located in Austria -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226257 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
| DNA | 226257-D50 | 50 μg of DNA in Tris buffer | $495 * | ||
| DNA | 226257-D100 | 100 μg of DNA in Tris buffer | $585 * | ||
* Log in to view industry pricing.
Backbone
-
Vector backbonepTwist CMV
- Backbone size w/o insert (bp) 4181
- Total vector size (bp) 6569
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP-AMPK-SPARK
-
Alt nameGCaMP6f-AMPK-SPARK
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2388
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GAGCTGGTTTAGTGAACCGT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTwist Biosciences
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 226257-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 226257-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GCaMP-AMPK-SPARK was a gift from Roland Malli (Addgene plasmid # 226257 ; http://n2t.net/addgene:226257 ; RRID:Addgene_226257) -
For your References section:
Development of a Dual Reporter System to Simultaneously Visualize Ca(2+) Signals and AMPK Activity. Erdogan YC, Pilic J, Gottschalk B, Yigit EN, Zaki AG, Ozturk G, Eroglu E, Okutan B, Sommer NG, Weinberg AM, Schindl R, Graier WF, Malli R. ACS Sens. 2024 Aug 21. doi: 10.1021/acssensors.4c01058. 10.1021/acssensors.4c01058 PubMed 39167044
