3xFLAG-DGKδ2
(Plasmid
#226506)
-
PurposeExpress N-terminal three tandem FLAG epitope tags, followed by an enterokinase cleavage site and human DGKD gene
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226506 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonep3xFLAG-CMV-7.1
-
Backbone manufacturerSigma Aldrich
- Backbone size w/o insert (bp) 4717
- Total vector size (bp) 8374
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDGKD
-
Alt nameDiacylglycerol kinase delta 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3642
-
GenBank IDNM_152879.3
-
Entrez GeneDGKD (a.k.a. DGK-delta, DGKdelta, dgkd-2)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Three tandem FLAG epitope tag (N terminal on backbone)
- enterokinase cleavage site (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
3xFLAG-DGKδ2 was a gift from Chiaki Murakami & Fumio Sakane (Addgene plasmid # 226506 ; http://n2t.net/addgene:226506 ; RRID:Addgene_226506) -
For your References section:
Diacylglycerol kinase delta and sphingomyelin synthase-related protein functionally interact via their sterile alpha motif domains. Murakami C, Hoshino F, Sakai H, Hayashi Y, Yamashita A, Sakane F. J Biol Chem. 2020 Mar 6;295(10):2932-2947. doi: 10.1074/jbc.RA119.012369. Epub 2020 Jan 24. 10.1074/jbc.RA119.012369 PubMed 31980461