Skip to main content

pTBL3241 PB-AtoBpegRNA-mCherry
(Plasmid #226666)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 226666 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 226666-D50 50 μg of DNA in Tris buffer $495
DNA 226666-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    MTK0 PiggyBac cargo backbone
  • Backbone manufacturer
    Hana El-Samad Lab
  • Modifications to backbone
    We removed the mammalian marker gene.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AtoB pegRNA
  • gRNA/shRNA sequence
    GCCATCATCACCATCATTGA
  • Species
    Synthetic

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Hana El-Samad (Mammalian Toolkit, Kit #1000000180).

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2021.11.05.467507 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTBL3241 PB-AtoBpegRNA-mCherry was a gift from Chang Liu (Addgene plasmid # 226666 ; http://n2t.net/addgene:226666 ; RRID:Addgene_226666)
  • For your References section:

    Open-ended molecular recording of sequential cellular events into DNA. Loveless TB, Carlson CK, Dentzel Helmy CA, Hu VJ, Ross SK, Demelo MC, Murtaza A, Liang G, Ficht M, Singhai A, Pajoh-Casco MJ, Liu CC. Nat Chem Biol. 2025 Apr;21(4):512-521. doi: 10.1038/s41589-024-01764-5. Epub 2024 Nov 14. 10.1038/s41589-024-01764-5 PubMed 39543397