pMH-HA/Joseph2-Multitagged Plasmid
(Plasmid
#226726)
-
PurposeValidates the expression and detection of epitope-tagged proteins of interest in mammalian cells.
-
Depositing Lab
-
Depositing OrganizationSan Diego State University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226726 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
| DNA | 226726-D50 | 50 μg of DNA in Tris buffer | $495 * | ||
| DNA | 226726-D100 | 100 μg of DNA in Tris buffer | $585 * | ||
* Log in to view industry pricing.
Backbone
-
Vector backbonepMH-HA
-
Backbone manufacturerAddgene
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepMH-HA/Joseph2
- Promoter CMV
-
Tag
/ Fusion Protein
- HA, Myc, GFP, Flag, V5, His
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 226726-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 226726-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMH-HA/Joseph2-Multitagged Plasmid was a gift from Richard Cripps (Addgene plasmid # 226726 ; http://n2t.net/addgene:226726 ; RRID:Addgene_226726) -
For your References section:
pJoseph2: a family of plasmids as positive controls for bacterial protein expression, transfections, and western blots. Robinson E, Alonso EB, A Waters J, Bileckyj C, D House C, A Johnston C, M Cripps R. Biotechniques. 2024;76(7):299-309. doi: 10.1080/07366205.2024.2343609. Epub 2024 May 12. 10.1080/07366205.2024.2343609 PubMed 39185782