p3E-nanos2 3'utr_R2-R3
(Plasmid
#226799)
-
Purpose3'-entry vector with the nanos2 3'utr cloned from Danio rerio. For use in Gateway cloning.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226799 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDONR-P2R-P3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2640
- Total vector size (bp) 3718
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namenanos2
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1075
-
Entrez Genenanos2
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATCAACCAATGCTGAATCTTTTTATAAAAAATTGAA
- 3′ sequencing primer AAATAAAATATATCAGGAGGAAACAAATATATCAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloned by Maya Pahima.
The putative zebrafish nos2 3'utr was cloned from zebrafish ovary gDNA using primers (3’-ATCAACCAATGCTGAATCTTTTTATAAAAAATTGAA-5' and 3’-AAATAAAATATATCAGGAGGAAACAAATATATCAGG-5') and inserted into the pCR4 cloning vector using the TOPO™ TA Cloning Kit (Thermo Fisher, K457502) for stabilization and sequencing (pCR4-nos2,3'utr). To insert the nos2,3’utr sequence into a Gateway Cloning vector, the region was amplified with attB primers (3'-GGGGACAGCTTTCTTGTACAAAGTGGTATATCAACCAATGCTGAATCTTTTTATAAAAAATTGAA-5' and 3'-GGGGACAACTTTGTATAATAAAGTTGTAAATAAAATATATCAGGAGGAAACAAATATATCAGG-5') and a BP reaction was performed with the Gateway BP Clonase II Enzyme mix (Invitrogen, 11789020) to recombine the amplicon into pDONR-P2R-P3 (Invitrogen, 12537-023) and produce p3E-nos2,3’utr.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p3E-nanos2 3'utr_R2-R3 was a gift from Florence Marlow (Addgene plasmid # 226799 ; http://n2t.net/addgene:226799 ; RRID:Addgene_226799)