pTol2Dest_nos2:d2GFP-nos2,3'utr_pCY
(Plasmid
#226801)
-
PurposeTransgenic expression of destabilized GFP (d2GFP) with the nanos2 3'utr control element under the nanos2 promoter. Includes a yellow eye (pCY; αcrystalin-a:Venus) marker.
-
Depositing Lab
-
Depositing OrganizationIcahn School of Medicine at Mount Sinai
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226801 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepTol2Dest_pCY
-
Backbone manufacturerChristian Mosimann
- Backbone size w/o insert (bp) 4974
- Total vector size (bp) 9545
-
Vector typeZebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namenanos2
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)2417
-
Entrez Genenanos2
- Promoter nanos2
Cloning Information for Gene/Insert 1
- Cloning method Gateway Cloning
- 5′ sequencing primer ACTGGCCTAAAGGGTGTCCT
- 3′ sequencing primer CGTCCCTTGCCTTTAGTCTG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namenanos2
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1075
-
Entrez Genenanos2
- Promoter nanos2
Cloning Information for Gene/Insert 2
- Cloning method Gateway Cloning
- 5′ sequencing primer ATCAACCAATGCTGAATCTTTTTATAAAAAATTGAA
- 3′ sequencing primer AAATAAAATATATCAGGAGGAAACAAATATATCAGG
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert named2egfp
-
SpeciesSynthetic
- Promoter nanos2
Cloning Information for Gene/Insert 3
- Cloning method Gateway Cloning
- 5′ sequencing primer M13F
- 3′ sequencing primer T7
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloned by Maya Pahima.
nos2 control elements were cloned from zebrafish ovary gDNA.
Gateway recombination: pTol2-nos2L:d2egfp-nos2,3’utr, cryaa:Venus (pCY) was generated by combining p5E-nos2promL, pME-d2GFP (Collery and Link, 2011), and pCR4-nos2,3’utr (Chapter 6) into the pTol2-R4/R3_cryaa:Venus backbone vector (Mosimann et al., 2013).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTol2Dest_nos2:d2GFP-nos2,3'utr_pCY was a gift from Florence Marlow (Addgene plasmid # 226801 ; http://n2t.net/addgene:226801 ; RRID:Addgene_226801)