pABE-dGFP-gRNA
(Plasmid
#226864)
-
PurposeHuman gRNA expression vector targeting the A111V mutation of non-fluorescent EGFP in plasmid pABE-dGFP; for use with ABEs
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 226864 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 226864-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 226864-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneMLM3636
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSp-gRNA
-
gRNA/shRNA sequenceCTCTACGCGGGTCTTGTAGT
-
SpeciesOther
- Promoter hU6
Cloning Information
- Cloning method Unknown
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 226864-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 226864-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pABE-dGFP-gRNA was a gift from Alexis Komor (Addgene plasmid # 226864 ; http://n2t.net/addgene:226864 ; RRID:Addgene_226864) -
For your References section:
Genome editing with programmable base editors in human cells. Osgood NRB, Zawalick NM, Sawyer CB, Cowan QT, Gu S, Mawson SJ, Ranzau BL, Li L, Gymrek M, Goren A, Komor AC. Methods Enzymol. 2025;712:351-404. doi: 10.1016/bs.mie.2025.01.001. Epub 2025 Feb 5. 10.1016/bs.mie.2025.01.001 PubMed 40121079