eiABE
(Plasmid
#227144)
-
PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with TadA8e and HMG-D domain was inserted between TadA-8e and eIscBn driven by CMV promoter
-
Depositing Lab
-
Depositing OrganizationEast China Normal University
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 227144 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 227144-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 227144-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namebpNLS-TadA-8e-linker-HMG-D-linker-nOgeuIscB-v3-bpNLS
-
SpeciesSynthetic
-
MutationD96R/E84R/V159R/H339A
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tctgaggtggagttttcccacga
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 227144-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 227144-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eiABE was a gift from Dali Li (Addgene plasmid # 227144 ; http://n2t.net/addgene:227144 ; RRID:Addgene_227144) -
For your References section:
Engineering IscB to develop highly efficient miniature editing tools in mammalian cells and embryos. Xue N, Hong D, Zhang D, Wang Q, Zhang S, Yang L, Chen X, Li Y, Han H, Hu C, Liu M, Song G, Guan Y, Wang L, Zhu Y, Li D. Mol Cell. 2024 Aug 22;84(16):3128-3140.e4. doi: 10.1016/j.molcel.2024.07.007. Epub 2024 Aug 2. 10.1016/j.molcel.2024.07.007 PubMed 39096898