pk335-CARGO-3mer-35kb-DSF
(Plasmid
#227492)
-
Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locus
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 227492 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepk335-BFP
-
Vector typeCRISPR
-
Selectable markersNeomycin (select with G418) ; TagBFP
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCARGO to 35kb Downstream Fgf5
-
Alt nameCARGOE1E2
-
gRNA/shRNA sequenceCTGCAGATACCTGCAGAGTT, CTTAATCATGTCTGTTTACC, TAAAATAACAGACTACTCCG
-
SpeciesM. musculus (mouse), Synthetic
Cloning Information
- Cloning method Other
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pk335-CARGO-3mer-35kb-DSF was a gift from Joanna Wysocka (Addgene plasmid # 227492 ; http://n2t.net/addgene:227492 ; RRID:Addgene_227492) -
For your References section:
Long-range regulation of transcription scales with genomic distance in a gene-specific manner. Jensen CL, Chen LF, Swigut T, Crocker OJ, Yao D, Bassik MC, Ferrell JE Jr, Boettiger AN, Wysocka J. Mol Cell. 2025 Jan 16;85(2):347-361.e7. doi: 10.1016/j.molcel.2024.10.021. Epub 2024 Dec 2. 10.1016/j.molcel.2024.10.021 PubMed 39626660