Skip to main content

pGH020 sgControl (GEA)
(Plasmid #228193)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228193 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pGH020
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Safe targeting sgRNA
  • gRNA/shRNA sequence
    GACCATGGAACTCACAAAAA
  • Species
    M. musculus (mouse)
  • Promoter human U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer CAAGGCTGTTAGAGAGATAATTGGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Bassik lab; pGH020 was generated in the Bassik lab and we used as a vector.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.09.17.612743 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGH020 sgControl (GEA) was a gift from Laura Attardi (Addgene plasmid # 228193 ; http://n2t.net/addgene:228193 ; RRID:Addgene_228193)
  • For your References section:

    Integrative multiomic approaches reveal ZMAT3 and p21 as conserved hubs in the p53 tumor suppression network. Boutelle AM, Mabene AR, Yao D, Xu H, Wang M, Tang YJ, Lopez SS, Sinha S, Demeter J, Cheng R, Benard BA, McCrea EM, Valente LJ, Drainas AP, Fischer M, Majeti R, Petrov DA, Jackson PK, Yang F, Winslow MM, Bassik MC, Attardi LD. Cell Death Differ. 2025 Apr 22. doi: 10.1038/s41418-025-01513-8. 10.1038/s41418-025-01513-8 PubMed 40263541