Skip to main content

pHSP90(G97D)-mOFP
(Plasmid #228195)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228195 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pmOFP-N1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    HSP90AA1(G97D)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2196
  • Mutation
    G97D mutation
  • Entrez Gene
    HSP90AA1 (a.k.a. EL52, HEL-S-65p, HSP86, HSP89A, HSP90A, HSP90N, HSPC1, HSPCA, HSPCAL1, HSPCAL4, HSPN, Hsp103, Hsp89, Hsp90, LAP-2, LAP2)
  • Promoter CMV
  • Tag / Fusion Protein
    • mOFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHSP90(G97D)-mOFP was a gift from Stephen Benkovic (Addgene plasmid # 228195 ; http://n2t.net/addgene:228195 ; RRID:Addgene_228195)
  • For your References section:

    Hsp70/Hsp90 chaperone machinery is involved in the assembly of the purinosome. French JB, Zhao H, An S, Niessen S, Deng Y, Cravatt BF, Benkovic SJ. Proc Natl Acad Sci U S A. 2013 Feb 12;110(7):2528-33. doi: 10.1073/pnas.1300173110. Epub 2013 Jan 28. 10.1073/pnas.1300173110 PubMed 23359685