pCMV-THRA-RFP-EGFP
(Plasmid
#228537)
-
PurposeBichromatic fluorescent reporter of THRA isoform 1 and isoform 2 splicing in mammalian cells
-
Depositing Lab
-
Depositing OrganizationCharite Universitaetsmedizin Berlin
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 228537 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 228537-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 228537-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-N3
-
Backbone manufacturerNovoPro
- Backbone size w/o insert (bp) 4445
- Total vector size (bp) 12547
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsKanamycin (final 50 ug/ml)
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameThyroid Hormone Receptor Alpha
-
Alt nameTHRA
-
Alt nameTRalpha
-
Alt nameTHRalpha
-
SpeciesH. sapiens (human)
-
Insert Size (bp)12547
-
GenBank IDENSG00000126351
-
Entrez GeneTHRA (a.k.a. AR7, CHNG6, EAR7, ERB-T-1, ERBA, ERBA1, NR1A1, THRA1, THRA2, THRalpha, THRalpha1, THRalpha2, TRalpha, TRalpha1, TRalpha2, c-ERBA-1, c-erbA)
- Promoter CMV
-
Tags
/ Fusion Proteins
- tagRFP (C terminal on insert)
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer tgacgtcaatgggagtttgt
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 228537-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 228537-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-THRA-RFP-EGFP was a gift from Markus Schuelke (Addgene plasmid # 228537 ; http://n2t.net/addgene:228537 ; RRID:Addgene_228537) -
For your References section:
Bichromatic Splicing Detector Allows Quantification of THRA1 and THRA2 Splicing Isoforms in Single Cells by Fluorescent Live-Cell Imaging. Graceffo E, Pedersen E, Rosario M, Krude H, Schuelke M. Int J Mol Sci. 2024 Dec 17;25(24):13512. doi: 10.3390/ijms252413512. 10.3390/ijms252413512 PubMed 39769274
Map uploaded by the depositor.
