pCJ1021
(Plasmid #228761)

• Purpose: Plasmid expressing Cas9 and 2 gRNAs for mouse Ift88. Use for disruption of mouse Ift88 in cultured cells.
• Depositing Lab: Bradley Yoder
• Depositing Organization: University of Alabama at Birmingham
  Located in the United States of America
• Publication: Plasmid expressing Cas9 and 2 gRNAs for mouse Pkd2 and Ift88 (unpublished)

Backbone

• Vector backbone: pSpCas9(BB)-2A-GFP (PX458)
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 9300
• Total vector size (bp): 9644
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Ift88 gRNAs
• gRNA/shRNA sequence: gRNA1: tcaatgggaagaccgatgac; gRNA2: GCAAAAGACGCTTCGATCAC
• Species: M. musculus (mouse)
• Entrez Gene: Ift88 (a.k.a. Tg737, Tg737Rpw, TgN737Rpw, Ttc10, flexo, fxo, orpk, polaris)
• Promoter: hU6
• Tags / Fusion Proteins:
  • 3XFLAG (N terminal on backbone)
  • GFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BbsI (destroyed during cloning)
• 3′ cloning site: SapI (destroyed during cloning)
• 5′ sequencing primer: agcgcgtgcgccaattctgcagacaaatggc
• 3′ sequencing primer: gccatttgtctgcagaattggcgcacgcgct

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 228761-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 228761-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.