Skip to main content

pCSCG-Fc-pST3Gal1 H302A
(Plasmid #228820)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 228820 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCSCG
  • Backbone size w/o insert (bp) 7772
  • Total vector size (bp) 9503
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Fc-pST3Gal1 H302A
  • Species
    H. sapiens (human); pig
  • Insert Size (bp)
    1731
  • Mutation
    amino acids 1-59 of pST3Gal1 were deleted and H302A is introduced in pST3Gal1
  • Promoter CMV
  • Tags / Fusion Proteins
    • human IgG1 Fc region (N terminal on insert)
    • 6His tag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGCATTGGTAGCTGCTGTA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Sriram Neelamegham (Addgene #228819)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert size includes N-terminal Fc portion.
Fc-pST3Gal1 H302A shows binding to Siaα2,3Galβ1,3[GlcNAc(β1,6)]GalNAcα-Ser/Thr, but does not have enzymatic activity.

Please visit https://doi.org/10.21203/rs.3.rs-5004188/v1 for the preprint.

Plasmid contains a truncation that affects lentiviral components in the plasmid. Plasmid can still be cloned using E. coli and shows normal expression after transient transfection, but cannot be used to produce lentiviral vectors.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCSCG-Fc-pST3Gal1 H302A was a gift from Sriram Neelamegham (Addgene plasmid # 228820 ; http://n2t.net/addgene:228820 ; RRID:Addgene_228820)
  • For your References section:

    Engineering glycosyltransferases into glycan binding proteins using a mammalian surface display platform. Hombu R, Beatty LE, Tomaszewski J, Park S, Neelamegham S. Nat Commun. 2025 Jul 18;16(1):6637. doi: 10.1038/s41467-025-62018-z. 10.1038/s41467-025-62018-z PubMed 40681527