pRSF-MjCouRS
(Plasmid
#229066)
-
PurposetRNA synthetase/tRNA pair for the in vivo incorporation of (7-hydroxy-4-coumarin-yl) ethylglycine (Hco), into proteins in E. coli in response to the amber (TAG) codon
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229066 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRSF
- Backbone size w/o insert (bp) 2469
- Total vector size (bp) 3390
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMethanococcus jannaschii tRNA synthetase
-
Alt nameCouRS
-
Alt name7-HCou Aminoacyl tRNA synthetase
-
SpeciesMethanococcus jannaschii
-
Insert Size (bp)921
- Promoter T7
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSF-MjCouRS was a gift from Thomas Huber (Addgene plasmid # 229066 ; http://n2t.net/addgene:229066 ; RRID:Addgene_229066) -
For your References section:
Rendering Proteins Fluorescent Inconspicuously: Genetically Encoded 4-Cyanotryptophan Conserves Their Structure and Enables the Detection of Ligand Binding Sites. Qianzhu H, Abdelkader EH, Welegedara AP, Habel E, Paul N, Frkic RL, Jackson CJ, Huber T, Otting G. Angew Chem Int Ed Engl. 2024 Dec 4:e202421000. doi: 10.1002/anie.202421000. 10.1002/anie.202421000 PubMed 39632265