Sec61β-Flag-APEX2-SOPP3
(Plasmid
#229072)
-
PurposeExpresse APEX2-SOPP3 in ER in mammalian cell
-
Depositing Lab
-
Depositing OrganizationShanghai Institute of Nutrition and Health, Chinese Academy of Sciences
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229072 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 229072-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 229072-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePCS2
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameExpress APEX2-SOPP3 in the ER
-
SpeciesH. sapiens (human)
-
Entrez GeneAPEX2 (a.k.a. APE2, APEXL2, XTH2, ZGRF2)
- Promoter CMV
Cloning Information
- Cloning method Other
- 5′ sequencing primer ATGCCTGGACCCGCAGCTAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 229072-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 229072-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Sec61β-Flag-APEX2-SOPP3 was a gift from Weijun Pan (Addgene plasmid # 229072 ; http://n2t.net/addgene:229072 ; RRID:Addgene_229072) -
For your References section:
Photoactivated SOPP3 enables APEX2-mediated proximity labeling with high spatio-temporal resolution in live cells. Qu D, Li Y, Liu Q, Cao B, Cao M, Lin X, Shen C, Zou P, Zhou H, Zhang W, Pan W. Cell Res. 2025 Feb;35(2):149-152. doi: 10.1038/s41422-024-01061-9. Epub 2024 Dec 10. 10.1038/s41422-024-01061-9 PubMed 39653757