pNVD006 T7-Type IIS-meGFP
(Plasmid
#229642)
-
PurposePURExpress IVTT expression Golden Gate backbone for C-terminal meGFP fusion proteins
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 229642 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePURExpress Control DHFR Plasmid
-
Backbone manufacturerNEB
- Total vector size (bp) 3036
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameType IIS Golden Gate Cloning Site
- Promoter T7
-
Tag
/ Fusion Protein
- meGFP (C terminal on insert)
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNVD006 T7-Type IIS-meGFP was a gift from Polly Fordyce (Addgene plasmid # 229642)