KPC2-pNic-Bsa4
(Plasmid
#231082)
-
Purposeexpresses Klebsiella pneumoniae carbapenemase-2 (KPC-2) under T7 with His tag
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas at Austin
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231082 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepNIC-Bsa4
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecarbapenemase-2
-
Alt nameKPC-2
-
Entrez Genekpc2 (a.k.a. pCRE79_15)
-
Tag
/ Fusion Protein
- 6x His tag (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TGTGTACGCGATGGATACCG
- 3′ sequencing primer CGGCATAGTCATTTGCCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KPC2-pNic-Bsa4 was a gift from Josh Beckham (Addgene plasmid # 231082 ; http://n2t.net/addgene:231082 ; RRID:Addgene_231082)