Skip to main content

pHD-FlpTag-DsRed-HDR-ph1
(Plasmid #231901)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 231901 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pHD-DsRed
  • Backbone manufacturer
    Kate O'Connor-Giles
  • Backbone size w/o insert (bp) 4048
  • Total vector size (bp) 5103
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Frt-Frt14-SD-GFP-SA-Frt-Frt14
  • Species
    Synthetic
  • Insert Size (bp)
    1352

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGTAAAACGACGGCCAGT
  • 3′ sequencing primer ATGGCTCATAACACCCCTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The FlpTag insertion consists of an inverted sequence containing a splice acceptor (SA), GFP, and a splice donor (SD), flanked on either side by FRT and FRT14 recombination sites. This configuration allows conditional protein tagging, where the cassette orientation is controlled by Flp recombinase, enabling specific expression of GFP in targeted cells or tissues.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHD-FlpTag-DsRed-HDR-ph1 was a gift from Alexander Borst (Addgene plasmid # 231901 ; http://n2t.net/addgene:231901 ; RRID:Addgene_231901)
  • For your References section:

    Conditional protein tagging methods reveal highly specific subcellular distribution of ion channels in motion-sensing neurons. Fendl S, Vieira RM, Borst A. Elife. 2020 Oct 20;9:e62953. doi: 10.7554/eLife.62953. 10.7554/eLife.62953 PubMed 33079061