pHD-FlpTag-DsRed-HDR-ph1
(Plasmid
#231901)
-
PurposedsDNA donor vector with 3xP3-DsRed and FlpTag-GFP for precise genomic targeting and integration of the FlpTag-GFP cassette with codon phase 1.
-
Depositing Lab
-
Depositing OrganizationMax Planck Institute for Biological Intelligence
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 231901 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHD-DsRed
-
Backbone manufacturerKate O'Connor-Giles
- Backbone size w/o insert (bp) 4048
- Total vector size (bp) 5103
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFrt-Frt14-SD-GFP-SA-Frt-Frt14
-
SpeciesSynthetic
-
Insert Size (bp)1352
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- 3′ sequencing primer ATGGCTCATAACACCCCTTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The FlpTag insertion consists of an inverted sequence containing a splice acceptor (SA), GFP, and a splice donor (SD), flanked on either side by FRT and FRT14 recombination sites. This configuration allows conditional protein tagging, where the cassette orientation is controlled by Flp recombinase, enabling specific expression of GFP in targeted cells or tissues.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHD-FlpTag-DsRed-HDR-ph1 was a gift from Alexander Borst (Addgene plasmid # 231901 ; http://n2t.net/addgene:231901 ; RRID:Addgene_231901) -
For your References section:
Conditional protein tagging methods reveal highly specific subcellular distribution of ion channels in motion-sensing neurons. Fendl S, Vieira RM, Borst A. Elife. 2020 Oct 20;9:e62953. doi: 10.7554/eLife.62953. 10.7554/eLife.62953 PubMed 33079061