pNEU-KlacRS
(Plasmid
#232155)
-
PurposeSite-specific incorporation of L-lactyl-lysine into target proteins in mammalian cells.
-
Depositing Lab
-
Depositing OrganizationNanjing University of Chinese Medicine
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232155 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 232155-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 232155-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepNEU-hMbPylRS-4xU6M15
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKlacRS1
-
SpeciesSynthetic
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid only has 3xU6M15, rather than 4x. The depositor has confirmed that this does not affect the functionality of the plasmid.
DNA (Catalog # 232155-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 232155-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNEU-KlacRS was a gift from Nanxi Wang (Addgene plasmid # 232155 ; http://n2t.net/addgene:232155 ; RRID:Addgene_232155) -
For your References section:
Genetic code expansion reveals site-specific lactylation in living cells reshapes protein functions. Shao C, Tang S, Yu S, Liu C, Zhang Y, Wan T, He Z, Yuan Q, Wu S, Zhang H, Wan N, Zhan M, Tan RX, Hao H, Ye H, Wang N. Nat Commun. 2025 Jan 8;16(1):227. doi: 10.1038/s41467-024-55165-2. 10.1038/s41467-024-55165-2 PubMed 39779673