tet3G-cmv-FRB-SMG7C-IRES-FKBP-HaloTag_tdMCP-NLS-HA (tet3G-RIDR)
(Plasmid
#232461)
-
PurposeDox-inducible, high expression RIDR
-
Depositing Lab
-
Depositing OrganizationJohns Hopkins University and School of Medicine
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 232461 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePSR1903 tet3G
- Backbone size w/o insert (bp) 8545
- Total vector size (bp) 12341
-
Vector typeMammalian Expression
-
Selectable markersPuromycin ; HaloTag
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametet3G-cmv-FRB-SMG7C-IRES-FKBP-HaloTag-tdMCP-NLS-HA
-
Alt nametet3G-RIDR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3796
- Promoter cmv
-
Tags
/ Fusion Proteins
- FRB-SMG7C (N terminal on insert)
- FKBP-HaloTag-tdMCP-NLS-HA (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (destroyed during cloning)
- 3′ cloning site EcoRV (not destroyed)
- 5′ sequencing primer GTTTCCTTCAGAGTCTGGGG
- 3′ sequencing primer CCTCATAAAGAGACAGCAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tet3G-cmv-FRB-SMG7C-IRES-FKBP-HaloTag_tdMCP-NLS-HA (tet3G-RIDR) was a gift from Bin Wu (Addgene plasmid # 232461 ; http://n2t.net/addgene:232461 ; RRID:Addgene_232461) -
For your References section:
A rapid inducible RNA decay system reveals fast mRNA decay in P-bodies. Blake LA, Watkins L, Liu Y, Inoue T, Wu B. Nat Commun. 2024 Mar 28;15(1):2720. doi: 10.1038/s41467-024-46943-z. 10.1038/s41467-024-46943-z PubMed 38548718