Skip to main content

tet3G-cmv-FRB-SMG7C-IRES-FKBP-HaloTag_tdMCP-NLS-HA (tet3G-RIDR)
(Plasmid #232461)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232461 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    PSR1903 tet3G
  • Backbone size w/o insert (bp) 8545
  • Total vector size (bp) 12341
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin ; HaloTag

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    tet3G-cmv-FRB-SMG7C-IRES-FKBP-HaloTag-tdMCP-NLS-HA
  • Alt name
    tet3G-RIDR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3796
  • Promoter cmv
  • Tags / Fusion Proteins
    • FRB-SMG7C (N terminal on insert)
    • FKBP-HaloTag-tdMCP-NLS-HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer GTTTCCTTCAGAGTCTGGGG
  • 3′ sequencing primer CCTCATAAAGAGACAGCAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tet3G-cmv-FRB-SMG7C-IRES-FKBP-HaloTag_tdMCP-NLS-HA (tet3G-RIDR) was a gift from Bin Wu (Addgene plasmid # 232461 ; http://n2t.net/addgene:232461 ; RRID:Addgene_232461)
  • For your References section:

    A rapid inducible RNA decay system reveals fast mRNA decay in P-bodies. Blake LA, Watkins L, Liu Y, Inoue T, Wu B. Nat Commun. 2024 Mar 28;15(1):2720. doi: 10.1038/s41467-024-46943-z. 10.1038/s41467-024-46943-z PubMed 38548718