Skip to main content

pLAS2w.Phyg-TIMD4
(Plasmid #232670)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 232670 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLAS2w.Phyg
  • Backbone manufacturer
    National RNAi Core Facility at Academia Sinica
  • Backbone size w/o insert (bp) 8564
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TIMD4
  • Alt name
    TIM4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1196
  • Entrez Gene
    TIMD4 (a.k.a. SMUCKLER, TIM4)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CMV Forward
  • 3′ sequencing primer ATTCTTTCCCCTGCACTGTAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLAS2w.Phyg-TIMD4 was a gift from Chen-Yang Shen (Addgene plasmid # 232670 ; http://n2t.net/addgene:232670 ; RRID:Addgene_232670)
  • For your References section:

    Functional genomic analysis reveals HAVCR1 as the key regulator of 5q33.3 locus linked to hyperlipidemia. Chen WT, Hsiung CN, Jou YS, Wang HC, Shen CY, Chou WC. HGG Adv. 2026 May 25:100630. doi: 10.1016/j.xhgg.2026.100630. 10.1016/j.xhgg.2026.100630 PubMed 42186223