pTon1(il11)
(Plasmid
#233647)
-
PurposeExpression vector of X. laevis il11.L-P2A-AcGFP1 under control of tetracycline responsive element (TRE). Also express Tet-on advenced transactivator (rtTA) under control of minimal CMV promoter.
-
Depositing Lab
-
Depositing OrganizationThe University of Tokyo
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233647 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 233647-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 233647-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTRE-tight
-
Backbone manufacturerClontech
- Total vector size (bp) 6194
-
Vector typeAmphibian Expression, Tet-on
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameinterleukin-11.L (350-913)
-
SpeciesX. laevis (frog)
-
Insert Size (bp)564
-
MutationSome synonymous substitutions were introduced in the il11.L sequence (see ref.)
-
Entrez Geneil11.L (a.k.a. agif, il-11, il11)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGAAAAGCAGTTTGTGCCA
- 3′ sequencing primer CAACTTGTTCTTCATCAGAA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametarget sequence of guide RNA #tyr (3905-3927) 5'-GGCTCCATGTCTTCCGTCCAAGG-3'
-
SpeciesX. laevis (frog)
-
Insert Size (bp)23
Cloning Information for Gene/Insert 2
- Cloning method Other
- 5′ sequencing primer GGCTCCATGTCTTCCGTCCAAGG
- 3′ sequencing primer CCTTGGACGGAAGACATGGAGCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 233647-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 233647-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTon1(il11) was a gift from Takeo Kubo (Addgene plasmid # 233647 ; http://n2t.net/addgene:233647 ; RRID:Addgene_233647) -
For your References section:
Interleukin-11 induces and maintains progenitors of different cell lineages during Xenopus tadpole tail regeneration. Tsujioka H, Kunieda T, Katou Y, Shirahige K, Fukazawa T, Kubo T. Nat Commun. 2017 Sep 8;8(1):495. doi: 10.1038/s41467-017-00594-5. 10.1038/s41467-017-00594-5 PubMed 28887447
