Skip to main content

pTon1(il11)
(Plasmid #233647)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 233647 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 233647-D50 50 μg of DNA in Tris buffer $495
DNA 233647-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pTRE-tight
  • Backbone manufacturer
    Clontech
  • Total vector size (bp) 6194
  • Vector type
    Amphibian Expression, Tet-on

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    interleukin-11.L (350-913)
  • Species
    X. laevis (frog)
  • Insert Size (bp)
    564
  • Mutation
    Some synonymous substitutions were introduced in the il11.L sequence (see ref.)
  • Entrez Gene
    il11.L (a.k.a. agif, il-11, il11)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGAAAAGCAGTTTGTGCCA
  • 3′ sequencing primer CAACTTGTTCTTCATCAGAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    target sequence of guide RNA #tyr (3905-3927) 5'-GGCTCCATGTCTTCCGTCCAAGG-3'
  • Species
    X. laevis (frog)
  • Insert Size (bp)
    23

Cloning Information for Gene/Insert 2

  • Cloning method Other
  • 5′ sequencing primer GGCTCCATGTCTTCCGTCCAAGG
  • 3′ sequencing primer CCTTGGACGGAAGACATGGAGCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTon1(il11) was a gift from Takeo Kubo (Addgene plasmid # 233647 ; http://n2t.net/addgene:233647 ; RRID:Addgene_233647)
  • For your References section:

    Interleukin-11 induces and maintains progenitors of different cell lineages during Xenopus tadpole tail regeneration. Tsujioka H, Kunieda T, Katou Y, Shirahige K, Fukazawa T, Kubo T. Nat Commun. 2017 Sep 8;8(1):495. doi: 10.1038/s41467-017-00594-5. 10.1038/s41467-017-00594-5 PubMed 28887447