pLenti Hs ATP13A4 E646D
(Plasmid
#233702)
-
Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A4 E646D mutant
-
Depositing Lab
-
Depositing OrganizationKatholieke Universiteit Leuven
Located in Belgium -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233702 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLentiviral transfer plasmid
-
Backbone manufacturerDidier Trono
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATP13A4 E646D
-
SpeciesH. sapiens (human)
-
MutationE646D
-
Entrez GeneATP13A4
- Promoter CMV
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGACCTTGCATTCCTTTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti Hs ATP13A4 E646D was a gift from Veerle Baekelandt (Addgene plasmid # 233702)