Skip to main content

miR3 MmATP13A4
(Plasmid #233705)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 233705 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    SIV transfer plasmid
  • Backbone manufacturer
    Didier Negre
  • Vector type
    Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    miR Atp13a4
  • gRNA/shRNA sequence
    5'-AGCCCATGAACTTCAAGCTCTA-3'
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Atp13a4 (a.k.a. 4631413J11Rik, 4832416L12, 9330174J19Rik)
  • Promoter SFFV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer TCATTTTACTGGGGGACCTTGTGCA
  • 3′ sequencing primer caacgggccacaactcctc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    miR3 MmATP13A4 was a gift from Veerle Baekelandt (Addgene plasmid # 233705)