Skip to main content

pLenti Hs ATP13A4 WT-Twinstrep-Flag
(Plasmid #233708)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 233708 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    Lentiviral transfer plasmid
  • Backbone manufacturer
    Didier Trono
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ATP13A4 WT
  • Species
    H. sapiens (human)
  • Entrez Gene
    ATP13A4
  • Promoter CMV
  • Tag / Fusion Protein
    • Twin-Strep-tag, FLAG-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SdaI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGACCTTGCATTCCTTTGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti Hs ATP13A4 WT-Twinstrep-Flag was a gift from Veerle Baekelandt (Addgene plasmid # 233708)