pLenti Hs ATP13A4 D486N-Twinstrep-Flag
(Plasmid
#233709)
-
Purposetransfer plasmid for lentiviral vector production expressing Hs ATP13A4 D486N mutant with Twinstrep-Flag tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 233709 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLentiviral transfer plasmid
-
Backbone manufacturerDidier Trono
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATP13A4 D486N
-
SpeciesH. sapiens (human)
-
MutationD486N
-
Entrez GeneATP13A4
- Promoter CMV
-
Tag
/ Fusion Protein
- Twin-Strep-tag, FLAG-tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SdaI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGACCTTGCATTCCTTTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti Hs ATP13A4 D486N-Twinstrep-Flag was a gift from Veerle Baekelandt (Addgene plasmid # 233709)