pLV-PGK-TetOn-Puro_MeltITSN1-37-mch
(Plasmid
#234068)
-
PurposeEncodes the Dbl homology and pleckstrin homology (DH-PH) domain of Intersectin1 controlled by a Melt variant with a switching temperature of 37°C
-
Depositing Lab
-
Depositing OrganizationUniversity of Pennsylvania
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234068 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLV-PGK-TetOn-Puro
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMeltITSN1-37-mCherry
-
SpeciesH. sapiens (human), Synthetic
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-PGK-TetOn-Puro_MeltITSN1-37-mch was a gift from Lukasz Bugaj (Addgene plasmid # 234068 ; http://n2t.net/addgene:234068 ; RRID:Addgene_234068) -
For your References section:
A temperature-inducible protein module for control of mammalian cell fate. Benman W, Huang Z, Iyengar P, Wilde D, Mumford TR, Bugaj LJ. Nat Methods. 2025 Jan 23. doi: 10.1038/s41592-024-02572-4. 10.1038/s41592-024-02572-4 PubMed 39849131