FLARE-pbCas9-mCherry
(Plasmid
#234494)
-
PurposeExpresses the Cas9 nuclease
-
Depositing Lab
-
Depositing OrganizationDartmouth College and Medical School
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234494 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonePB-CMV-MCS-EF1-puro
-
Vector typeMammalian Expression
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACTAGAAGGCACAGTCGAGGCTGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.03.21.586160 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLARE-pbCas9-mCherry was a gift from Aaron McKenna (Addgene plasmid # 234494 ; http://n2t.net/addgene:234494 ; RRID:Addgene_234494) -
For your References section:
Hierarchical lineage tracing reveals diverse pathways of cytarabine resistance. Saxe R, Stuart H, Marshall AC, Abdullahi F, Chen Z, Emiliani F, McKenna A. Nat Commun. 2026 Jun 30. doi: 10.1038/s41467-026-74989-8. 10.1038/s41467-026-74989-8 PubMed 42380134