Skip to main content

pAAV-cytoFLARE1.1-TEV
(Plasmid #234518)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 234518 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *

* Log in to view industry pricing.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EGFP-P2A-CaM-V5-TEVp
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcgaccatctgcgctgcggcgcc
  • 3′ sequencing primer cacatagcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.01.13.632875 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-cytoFLARE1.1-TEV was a gift from Wenjing Wang (Addgene plasmid # 234518 ; http://n2t.net/addgene:234518 ; RRID:Addgene_234518)
  • For your References section:

    An improved FLARE system for recording and manipulating neuronal activity. Zhou G, Li R, Bartolik O, Ma Y, Wan WW, Meng J, Hu Y, Ye B, Wang W. Cell Rep Methods. 2025 Apr 21;5(4):101012. doi: 10.1016/j.crmeth.2025.101012. Epub 2025 Mar 21. 10.1016/j.crmeth.2025.101012 PubMed 40120579