Skip to main content

pAAV-Esyn-FlpX-TVA950-EYFP-WPRE
(Plasmid #234710)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234710 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV eSyn FlpX
  • Backbone size w/o insert (bp) 4778
  • Total vector size (bp) 6164
  • Vector type
    Mammalian Expression, AAV ; has fDIO cassette for Flp-dependent expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TVA950-eYFP
  • Species
    Synthetic; Coturnix japonica and synthetic
  • Insert Size (bp)
    1224
  • GenBank ID
    OR551243.1
  • Promoter enhanced Synapsin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer gcacgggcgcgaccatctgc
  • 3′ sequencing primer gtaatccagaggttgattatcgataagctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.08.28.610136 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Esyn-FlpX-TVA950-EYFP-WPRE was a gift from David Ng (Addgene plasmid # 234710 ; http://n2t.net/addgene:234710 ; RRID:Addgene_234710)
  • For your References section:

    Segregated basal ganglia output pathways correspond to genetically divergent neuronal subclasses. Mendelsohn AI, Nikoobakht L, Bikoff JB, Costa RM. Cell Rep. 2025 Apr 22;44(4):115454. doi: 10.1016/j.celrep.2025.115454. Epub 2025 Mar 25. 10.1016/j.celrep.2025.115454 PubMed 40146776