pAAV-Esyn-FlpX-TVA950-EYFP-WPRE
(Plasmid
#234710)
-
PurposepAAV transfer plasmid with enhanced Synapsin promoter driving Flp-dependent expression of TVA950-eYFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234710 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV eSyn FlpX
- Backbone size w/o insert (bp) 4778
- Total vector size (bp) 6164
-
Vector typeMammalian Expression, AAV ; has fDIO cassette for Flp-dependent expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTVA950-eYFP
-
SpeciesSynthetic; Coturnix japonica and synthetic
-
Insert Size (bp)1224
-
GenBank IDOR551243.1
- Promoter enhanced Synapsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer gcacgggcgcgaccatctgc
- 3′ sequencing primer gtaatccagaggttgattatcgataagctg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.08.28.610136 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Esyn-FlpX-TVA950-EYFP-WPRE was a gift from David Ng (Addgene plasmid # 234710 ; http://n2t.net/addgene:234710 ; RRID:Addgene_234710) -
For your References section:
Segregated basal ganglia output pathways correspond to genetically divergent neuronal subclasses. Mendelsohn AI, Nikoobakht L, Bikoff JB, Costa RM. bioRxiv [Preprint]. 2024 Sep 18:2024.08.28.610136. doi: 10.1101/2024.08.28.610136. 10.1101/2024.08.28.610136 PubMed 39257765