Skip to main content

pTcTurboID-GW_GFP
(Plasmid #234715)

  • Purpose
    Used to express GFP fused to 3xHA-TurboID (N-terminal) in T. cruzi. Tetracycline regulated. Used as proximity labelling cytoplasmatic spatial control. CDS can be cloned in frame to GFP using EcoRV.
  • Depositing Lab
  • Depositing Organization
    Instituto de Biologia Molecular y Celular de Rosario
    Located in Argentina
  • Sequence Information

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 234715 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pTcTurboID-GW
  • Vector type
    Trypanosomatid expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP
  • Species
    Other
  • Promoter T7
  • Tag / Fusion Protein
    • 3xHA (N terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ataaacagggagccctgc
  • 3′ sequencing primer CAAGGACAGAAAACGGTAAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

If you want to perform traditional cloning (instead of Gateway recombiantion), it can be achieved by replacing the GFP cassette from pTcTurboID-GW_GFP with the desired CDS using BamHI and EcoRV restriction enzymes. Also, any CDS can be cloned in frame to GFP using only EcoRV.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTcTurboID-GW_GFP was a gift from Esteban Serra (Addgene plasmid # 234715 ; http://n2t.net/addgene:234715 ; RRID:Addgene_234715)