pCAG-eCas9-T2A-EGFP-U6-gRNA targeting Nrl-no ITR and f1 ori
(Plasmid
#234737)
-
PurposeAll-in-one CRISPR/Cas9 vector encodes high-fidelity eSpCas9 and a gRNA targeting Nrl, efficiently reprogramming rod precursors into cone-like cells in the mouse retina.
-
Depositing Lab
-
Depositing OrganizationUF Scripps Biomedical Research
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234737 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAG-eCas9-T2A-EGFP-U6-gRNA-no ITR and f1 ori
-
Backbone manufacturerKirill Martemyanov, Addgene plasmid #234724
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNrl
-
gRNA/shRNA sequenceGTATGGTGTGGAGCCCAACG
-
SpeciesM. musculus (mouse)
-
GenBank ID18185
-
Entrez GeneNrl (a.k.a. D14H14S46E)
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-eCas9-T2A-EGFP-U6-gRNA targeting Nrl-no ITR and f1 ori was a gift from Kirill Martemyanov (Addgene plasmid # 234737 ; http://n2t.net/addgene:234737 ; RRID:Addgene_234737) -
For your References section:
Efficient in vivo labeling of endogenous proteins with SMART delineates retina cellular and synaptic organization. Zhao C, Cao Y, Ibrahim N, Wang Y, Martemyanov KA. Nat Commun. 2025 Apr 22;16(1):3768. doi: 10.1038/s41467-025-58945-6. 10.1038/s41467-025-58945-6 PubMed 40263339