pLenti-CMV-EGFRvIII-IRES-EGFP
(Plasmid #234862)

• Purpose: Expresses truncated EGFRvIII (exons 2-7 deletion) and EGFP in mammalian cells under a CMV promoter.
• Depositing Lab: David Nathanson
• Depositing Organization: University of California, Los Angeles (UCLA)
  Located in the United States of America
• Publication: Lentiviral vectors for the expression of oncogenic EGFR variants in GBM and NSCLC (unpublished)

Backbone

• Vector backbone: pLenti
• Backbone size w/o insert (bp): 7571
• Total vector size (bp): 10425
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: EGFP fluorescence

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Epidermal Growth Factor Receptor variant III
• Alt name: EGFRvIII
• Alt name: EGFR-vIII
• Alt name: EGFR de2-7
• Species: H. sapiens (human)
• Insert Size (bp): 2742
• Mutation: Deletion of exons 2-7 (aa6-273)
• Entrez Gene: EGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, NNCIS, PIG61, mENA)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (destroyed during cloning)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: ATGCGACCCTCCGGG
• 3′ sequencing primer: TGCTCCAATAAATTCACTGCTTTGTGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry