pLVXNeo_BGN-SBP-mSc
(Plasmid
#234884)
-
PurposeExpresses mScarlet-i and SBP tagged human biglycan for protein visualisation and use in the RUSH trafficking system
-
Depositing Lab
-
Depositing OrganizationUniversity of Bristol
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 234884 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLVXNeo
-
Backbone manufacturerTakara
- Backbone size w/o insert (bp) 8317
- Total vector size (bp) 10228
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBiglycan
-
Alt nameBGN
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1982
-
MutationSee Depositor Comments below
-
GenBank IDNM_001711.6
-
Entrez GeneBGN (a.k.a. DSPG1, MRLS, PG-S1, PGI, SEMDX, SLRR1A)
- Promoter CMV
-
Tags
/ Fusion Proteins
- SBP (C terminal on insert)
- mScarleti (C terminal on insert)
Cloning Information
- Cloning method Other
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: This plasmid contains a K199Q mutation in mScarlet-I. This mutation is not known to impact plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLVXNeo_BGN-SBP-mSc was a gift from Nicola Stevenson (Addgene plasmid # 234884 ; http://n2t.net/addgene:234884 ; RRID:Addgene_234884) -
For your References section:
Multiple golgins are required to support extracellular matrix secretion, modification, and assembly. Thompson G, Hoyle A, Lewis PA, Prada-Sanchez ME, Swift J, Heesom K, Lowe M, Stephens D, Stevenson NL. J Cell Biol. 2025 Oct 6;224(10):e202411167. doi: 10.1083/jcb.202411167. Epub 2025 Aug 18. 10.1083/jcb.202411167 PubMed 40824304